View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15631_high_1 (Length: 272)

Name: NF15631_high_1
Description: NF15631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15631_high_1
NF15631_high_1
[»] chr1 (1 HSPs)
chr1 (20-269)||(36253465-36253714)


Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 269
Target Start/End: Complemental strand, 36253714 - 36253465
Alignment:
Q  20 ttgacattaacaatgacgattcagacaatgaaaagtttgacaatgacaatgttgaagaccaaatggacaatgtggatgatgatgaaaaggaccattttct 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  36253714 ttgacattaacaatgacgattcagacaatgaaaagtttgacaatgacaatgttgaagaccaaatggacaatgtggatgatgacgaaaaggaccattttct 36253615  T
Q  120 aggtccttacaatgtggatgaagaccaaatggacaacattcccattgcacttgccgtttctgatgcatcccccgttgtgacggtggccatggctgccccc 219  Q
    | |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36253614 atgtccatacaatgtggatgaagaccaaatggacaatattcccattgcacttgccgtttctgatgcatcccccgttgtgacggtggccatggctgccccc 36253515  T
Q  220 gcagatgacacaaacgcggcaacaaacacagccaccacctatgctactac 269  Q
    ||||||||||||||||||||||||||||||||||||||||  ||||||||    
T  36253514 gcagatgacacaaacgcggcaacaaacacagccaccacctcggctactac 36253465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University