View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15629_high_33 (Length: 311)

Name: NF15629_high_33
Description: NF15629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15629_high_33
NF15629_high_33
[»] chr4 (3 HSPs)
chr4 (179-272)||(44104558-44104655)
chr4 (43-96)||(44104738-44104791)
chr4 (272-305)||(44104507-44104540)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 179 - 272
Target Start/End: Complemental strand, 44104655 - 44104558
Alignment:
Q  179 attcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaa----atatgatggaatggagtggtatggaatgtggt 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||    
T  44104655 attcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaaatatatatgatggaatggagtggtatggaatgtggt 44104558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 44104791 - 44104738
Alignment:
Q  43 ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttgg 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44104791 ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttgg 44104738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 305
Target Start/End: Complemental strand, 44104540 - 44104507
Alignment:
Q  272 tgaaaaattagtggaatagagtgatgtatgatga 305  Q
    ||||||||||||||||||||||||| ||||||||    
T  44104540 tgaaaaattagtggaatagagtgatatatgatga 44104507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University