View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15618_low_10 (Length: 248)

Name: NF15618_low_10
Description: NF15618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15618_low_10
NF15618_low_10
[»] chr4 (1 HSPs)
chr4 (18-231)||(43506413-43506626)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 43506626 - 43506413
Alignment:
Q  18 aaagagaaactaaatgtagagaaaatgttgagaatgagaagcgtggttataaagagcttttgcaaaaagatgagatgcatgaagcttatgagaagctact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43506626 aaagagaaactaaatgtagagaaaatgttgagaatgagaagcgtggttataaagagcttttgcaaaaagatgagatgcatgaagcttatgagaagctact 43506527  T
Q  118 taaggatgcggagattaggcttgtgaagatttatgagaatgatggtggagatggtaatgatgataatgacgtggttgaagataaggaatgtgaagaacgt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43506526 taaggatgcggagattaggcttgtgaagatttatgagaatgatggtggagatggtaatgatgataatgacgtggttgaagataaggaatgtgaagaacgt 43506427  T
Q  218 gttatgaggatatt 231  Q
    ||||||||||||||    
T  43506426 gttatgaggatatt 43506413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University