View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15587_low_26 (Length: 202)

Name: NF15587_low_26
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15587_low_26
NF15587_low_26
[»] chr2 (1 HSPs)
chr2 (1-188)||(39339728-39339914)
[»] chr1 (1 HSPs)
chr1 (15-48)||(27667027-27667060)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 39339914 - 39339728
Alignment:
Q  1 aattacatgattctcatataaatttagttgaatttatgtgaattttaactcatnnnnnnnnntgtcttgaaaaatactaaatgtttaagggtcttgnnnn 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||| ||||||||||||||||        
T  39339914 aattacgtgattctcatataaatttagttgaatttatgtgaattttaactcataaaaaaaaatgtcttgaaaaatactatatgtttaagggtcttgaaaa 39339815  T
Q  101 nnnnntggcataaatatttaaaaggtggtgtagtttattctcaattactcaagttccttctttactttttatcataaggtggtggatg 188  Q
         |||||| || ||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  39339814 aaaa-tggcatgaacattcaagaggtggtgtagtttattctcaattactcaagttccttctttattttttatcataaggtggtggatg 39339728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 27667060 - 27667027
Alignment:
Q  15 catataaatttagttgaatttatgtgaattttaa 48  Q
    |||||||||||||| |||||||||||||||||||    
T  27667060 catataaatttagtagaatttatgtgaattttaa 27667027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University