View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15587_low_20 (Length: 257)

Name: NF15587_low_20
Description: NF15587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15587_low_20
NF15587_low_20
[»] chr3 (1 HSPs)
chr3 (213-249)||(38482898-38482934)


Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 38482898 - 38482934
Alignment:
Q  213 tcaaagcagctgaccaagacttgagaactcctttgct 249  Q
    |||||||||||||||||||||||||||||||||||||    
T  38482898 tcaaagcagctgaccaagacttgagaactcctttgct 38482934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University