View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15584_high_4 (Length: 382)

Name: NF15584_high_4
Description: NF15584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15584_high_4
NF15584_high_4
[»] chr8 (2 HSPs)
chr8 (12-167)||(2661020-2661175)
chr8 (242-379)||(2661253-2661390)
[»] chr7 (2 HSPs)
chr7 (250-375)||(25951995-25952117)
chr7 (255-375)||(25945404-25945521)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 12 - 167
Target Start/End: Original strand, 2661020 - 2661175
Alignment:
Q  12 ataggcctggtttagggttaggttttgggtcggctagtgtatcggggtctggtctaggatttaattctggtcgtggtgtgaatggttcagataggaatga 111  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2661020 ataggcctggttttgggttaggttttgggtcggctagtgtatcggggtctggtctaggatttaattctggtcgtggtgtgaatggttcagataggaatga 2661119  T
Q  112 tgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2661120 tgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg 2661175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 242 - 379
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
Q  242 ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata 341  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  2661253 ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata 2661352  T
Q  342 aagggggtggtcttgggaagaatgagcagggtatttta 379  Q
    ||||||||||||||||||||||||||||||||||||||    
T  2661353 aagggggtggtcttgggaagaatgagcagggtatttta 2661390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 250 - 375
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
Q  250 gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt 349  Q
    |||| ||||||||||||| || || ||||||||||||||| ||||| |||   | ||||| |||||||||||| | ||||| |||||||||||||| |||    
T  25951995 gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt 25952091  T
Q  350 ggtcttgggaagaatgagcagggtat 375  Q
    ||||||||||||||||||||||||||    
T  25952092 ggtcttgggaagaatgagcagggtat 25952117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 255 - 375
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
Q  255 taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct 354  Q
    ||||||| ||||  || ||||||||||||||||| |||| |  ||| || ||||| |||||||||||| | ||||| |||||||||||||| ||||||||    
T  25945404 taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct 25945500  T
Q  355 tgggaagaatgagcagggtat 375  Q
    |||||||||||||||||||||    
T  25945501 tgggaagaatgagcagggtat 25945521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University