View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15576_low_2 (Length: 494)

Name: NF15576_low_2
Description: NF15576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15576_low_2
NF15576_low_2
[»] chr7 (1 HSPs)
chr7 (202-484)||(46597205-46597487)
[»] chr6 (1 HSPs)
chr6 (154-233)||(16860599-16860678)
[»] chr8 (1 HSPs)
chr8 (180-245)||(9183363-9183428)


Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 202 - 484
Target Start/End: Original strand, 46597205 - 46597487
Alignment:
Q  202 ggaccggatggtctgaatcctgctttttaccaccgtttttggaaggaattaggtggagaaatattttatgttgcttcctcttggctcacttctagttcct 301  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||    
T  46597205 ggaccggatggtctgaattctgctttttaccaccgtttttggaaggaattaggtggagaaatattttttgttgcttcctcttggctcacttctggttcct 46597304  T
Q  302 ttccccctgagttgaatgccacacacatcgtgctcgctccaaaggatgattacccggaatatatgaaagaccttcgccctatctccctctttaatatcct 401  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| ||||    
T  46597305 ttccccctgagttgaatgccacacacatcgtgctcgctccaaagggtgataacccggaatatatgaaagaccttcgccctatctccctctgtaatgtcct 46597404  T
Q  402 atacaaaattatttctaaggtgctggctaaccgccttcgccctttgattgataaatggatatctacagaacaagctgcctttg 484  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46597405 atataaaattatttctaaggtgctggctaaccgccttcgccctttgattgataaatggatatctacagaacaagctgcctttg 46597487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 16860599 - 16860678
Alignment:
Q  154 caagaatttcatgaagcaatatttaatatgcatcctgataaatcccccggaccggatggtctgaatcctgctttttacca 233  Q
    ||||||||| | || ||||| |||| ||||||||| |||||||| || || ||||||||||| ||||| || ||||||||    
T  16860599 caagaatttaaagaggcaatttttagtatgcatccggataaatctccgggtccggatggtctaaatccagcattttacca 16860678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 180 - 245
Target Start/End: Complemental strand, 9183428 - 9183363
Alignment:
Q  180 tatgcatcctgataaatcccccggaccggatggtctgaatcctgctttttaccaccgtttttggaa 245  Q
    ||||||||| |||||||| || ||||| || ||||| ||||||||||||| |||||| || |||||    
T  9183428 tatgcatccagataaatcacctggacctgacggtcttaatcctgcttttttccaccgattctggaa 9183363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University