View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15575_low_45 (Length: 226)

Name: NF15575_low_45
Description: NF15575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15575_low_45
NF15575_low_45
[»] chr1 (4 HSPs)
chr1 (92-226)||(46159466-46159600)
chr1 (1-97)||(46159679-46159775)
chr1 (92-133)||(46159593-46159634)
chr1 (102-174)||(46166446-46166519)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 92 - 226
Target Start/End: Complemental strand, 46159600 - 46159466
Alignment:
Q  92 tttgcaccactatgctagctcggctccccaggcctttgcacctcttttcagaacatgcataatcaatcatagataagtggaaacagaagcttcattttcc 191  Q
    ||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||    
T  46159600 tttgcaccactatgctagctcagctccacaggcctttgcacctcttttctgaacatgcataatcaatcatagatgagttgaaacagaagcttcattttcc 46159501  T
Q  192 tcattttatgtttgattttcagtatgttgtccttt 226  Q
    |||||||||||||||||||||||||||||||||||    
T  46159500 tcattttatgtttgattttcagtatgttgtccttt 46159466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 46159775 - 46159679
Alignment:
Q  1 tttctaaagcaagaagcgagaaagttacggttcggattacaacaatactctggagcagtactgcgggggttgtcgccccagtaacaaacagtttgca 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  46159775 tttctaaagcaagaagcgagaaagttacggttcggattacaacaatactctggagcagtactgcgggggttgtcgcccccgtaacaaacagtttgca 46159679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 133
Target Start/End: Complemental strand, 46159634 - 46159593
Alignment:
Q  92 tttgcaccactatgctagctcggctccccaggcctttgcacc 133  Q
    ||||||||||||||||||||| ||||||||||||||||||||    
T  46159634 tttgcaccactatgctagctcagctccccaggcctttgcacc 46159593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 46166519 - 46166446
Alignment:
Q  102 tatgctagctcggctccccaggcctttgcacctcttttca-gaacatgcataatcaatcatagataagtggaaa 174  Q
    ||||||||||| || ||||| |||||||| |||||||| | | ||||||||||| |||||||||| ||| ||||    
T  46166519 tatgctagctcagccccccatgcctttgcccctctttttatgcacatgcataattaatcatagatgagttgaaa 46166446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University