View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15563_low_11 (Length: 233)

Name: NF15563_low_11
Description: NF15563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15563_low_11
NF15563_low_11
[»] chr8 (2 HSPs)
chr8 (59-233)||(10163468-10163642)
chr8 (1-34)||(10163658-10163691)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 59 - 233
Target Start/End: Complemental strand, 10163642 - 10163468
Alignment:
Q  59 cttgatctctttcaatggctctatggtttgtggtttttgcaaatatatggatgcacatggataatggagctaattataataggaaaaggaggtgtataga 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10163642 cttgatctctttcaatggctctatggtttgtggtttttgcaaatatatagatgcacatggataatggagctaattataataggaaaaggaggtgtataga 10163543  T
Q  159 aaggtaaggttggttactttggaagaagggacaagaaattgatgactagaaagcggtaaagcttagattacagaa 233  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||    
T  10163542 aaggtaaggttggttactttggaaaaagggacaagaaattgatgactagaaagtggtaaagcttagattacagaa 10163468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 10163691 - 10163658
Alignment:
Q  1 actggcccccaatctgacatcttcactcactctt 34  Q
    ||||||||||||||||||||||||||||||||||    
T  10163691 actggcccccaatctgacatcttcactcactctt 10163658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University