View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1555_low_7 (Length: 260)

Name: NF1555_low_7
Description: NF1555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1555_low_7
NF1555_low_7
[»] chr4 (1 HSPs)
chr4 (18-249)||(43205121-43205353)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 43205121 - 43205353
Alignment:
Q  18 attttaacactcttatattcattcttttattgaatacaattttgaaaattacatgtcacacataaaatggtggaaaccatataaaagtt-gcgagaccca 116  Q
    ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  43205121 attttaacactcttatattcattcttttattaaatagaattttgaaaattacatgtcacacataaaatggtggaaaccatataaaagtttgcgagaccca 43205220  T
Q  117 agcaaatttcataaaatgagaaagtgttggaagagtcacggtagatatcacgattgatcttaataacactcaacaattataaatttcacctaatattata 216  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||| ||||    
T  43205221 agcaaatttcatgaaatgagaaagtgttggaagagtcacggtagatatcactattgatcctaataacactcaacaattataaatttcagctaataatata 43205320  T
Q  217 gtgcatgtttggaatcacatcgtttagtagaat 249  Q
    |||||||||||||||||||||||||||||||||    
T  43205321 gtgcatgtttggaatcacatcgtttagtagaat 43205353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University