View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15554_high_42 (Length: 250)

Name: NF15554_high_42
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15554_high_42
NF15554_high_42
[»] chr4 (3 HSPs)
chr4 (158-250)||(2243799-2243891)
chr4 (106-165)||(2243724-2243783)
chr4 (36-85)||(2243682-2243731)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 158 - 250
Target Start/End: Original strand, 2243799 - 2243891
Alignment:
Q  158 ttgattatacgttttcttgtagtatcaaagttatatgtattaggttaacaaattaatctatttactaaatgctgatactgatttttatgtttc 250  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  2243799 ttgattatactttttcttgtagtatcaaagttatatgtattaggttaacaaattaatctatttactaaatgccgatactgatttttatgtttc 2243891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 106 - 165
Target Start/End: Original strand, 2243724 - 2243783
Alignment:
Q  106 cattcaacatgtaagaatccccaaacttcattctttttgcttttcaatgatcttgattat 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  2243724 cattcaacatgtaagaatccccaaacttcattctttttgcttttcaatgattttgattat 2243783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 2243682 - 2243731
Alignment:
Q  36 ctcaaaaaaccgttctcaactttcctctcgttctctcaaactcactcaac 85  Q
    |||||| |||||||||||||||||||||||||||||||| |||| |||||    
T  2243682 ctcaaagaaccgttctcaactttcctctcgttctctcaacctcattcaac 2243731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University