View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15550_high_18 (Length: 201)

Name: NF15550_high_18
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15550_high_18
NF15550_high_18
[»] chr7 (1 HSPs)
chr7 (19-73)||(19707795-19707849)


Alignment Details
Target: chr7 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 19707849 - 19707795
Alignment:
Q  19 actagcatcctttaactctatgtcatatgtcttatgatgtttttgaaaagatctc 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19707849 actagcatcctttaactctatgtcatatgtcttatgatgtttttgaaaagatctc 19707795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University