View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15550_high_14 (Length: 224)

Name: NF15550_high_14
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15550_high_14
NF15550_high_14
[»] chr4 (1 HSPs)
chr4 (16-204)||(2873951-2874138)
[»] chr2 (3 HSPs)
chr2 (151-205)||(44213528-44213582)
chr2 (161-205)||(44225689-44225733)
chr2 (161-205)||(44236502-44236546)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 2873951 - 2874138
Alignment:
Q  16 ataatactattataaagttctcttatactagaaaagttaaattactctcgaaaaattagagaaagatcgaaaaaattagattagtcttcaattttgacgt 115  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2873951 ataatactatt-taaagttctcttatactagaaaagttaaattactctcgaaaaattagagaaagatcgaaaaaattagattagtcttcaattttgacgt 2874049  T
Q  116 ttctaagacttcatttttcacctctaatttttctattgcagatactggggttggatatatgtgctgataccatggtaggagatgaaatg 204  Q
    |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  2874050 ttctaacacttcatttttcacctctaatttttctattgcagatattggggttggatatatgtgctgataccatggtaggagatgaaatg 2874138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 44213582 - 44213528
Alignment:
Q  151 ttgcagatactggggttggatatatgtgctgataccatggtaggagatgaaatgt 205  Q
    ||||||||  ||||||||||||||||||| |||||||||||||| ||||||||||    
T  44213582 ttgcagattttggggttggatatatgtgcggataccatggtaggggatgaaatgt 44213528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 44225733 - 44225689
Alignment:
Q  161 tggggttggatatatgtgctgataccatggtaggagatgaaatgt 205  Q
    |||||||||||||||| || ||||||||||| |||||||||||||    
T  44225733 tggggttggatatatgcgcggataccatggtgggagatgaaatgt 44225689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 44236546 - 44236502
Alignment:
Q  161 tggggttggatatatgtgctgataccatggtaggagatgaaatgt 205  Q
    |||||||||||||||| || ||||||||||| |||||||||||||    
T  44236546 tggggttggatatatgcgcggataccatggtgggagatgaaatgt 44236502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University