View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1554_low_14 (Length: 211)

Name: NF1554_low_14
Description: NF1554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1554_low_14
NF1554_low_14
[»] chr2 (3 HSPs)
chr2 (33-190)||(515566-515723)
chr2 (102-179)||(560624-560701)
chr2 (109-174)||(8823054-8823119)
[»] chr5 (1 HSPs)
chr5 (102-161)||(20229263-20229322)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 33 - 190
Target Start/End: Original strand, 515566 - 515723
Alignment:
Q  33 gagacaatacaaggagtgaaaggacgaaagctttgtagaaaagagtgtgtgtgagtaatggaggaagaagaaggagaagcattttctaagtgaccttgtg 132  Q
    |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  515566 gagacaatacaaagagtgaaaggacgaaaactttgtagaaaagagtgtgtgtgagtaatggaggaagaagaaggagaagcgttttctaggtgaccttgtg 515665  T
Q  133 ggaaataataaacccttgaatgcaactttggaattttgacggcagcggcagcacatgt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  515666 ggaaataataaacccttgaatgcaactttggaattttgacggcagcggtagcacatgt 515723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 102 - 179
Target Start/End: Complemental strand, 560701 - 560624
Alignment:
Q  102 gaaggagaagcattttctaagtgaccttgtgggaaataataaacccttgaatgcaactttggaattttgacggcagcg 179  Q
    |||| |||||||| ||||||||| |||||||| ||||| ||||| || |||||||||||||| |||| ||||||||||    
T  560701 gaagaagaagcatgttctaagtggccttgtggaaaatagtaaactctggaatgcaactttggtatttggacggcagcg 560624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 174
Target Start/End: Complemental strand, 8823119 - 8823054
Alignment:
Q  109 aagcattttctaagtgaccttgtgggaaataataaacccttgaatgcaactttggaattttgacgg 174  Q
    |||||| ||||||||||||||| |||||||| |||||| ||||||| |  || |||||||||||||    
T  8823119 aagcatgttctaagtgaccttgcgggaaatagtaaacctttgaatgaagtttaggaattttgacgg 8823054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 161
Target Start/End: Complemental strand, 20229322 - 20229263
Alignment:
Q  102 gaaggagaagcattttctaagtgaccttgtgggaaataataaacccttgaatgcaacttt 161  Q
    |||| |||||||| ||||||||| |||||||| ||||| ||||| |||||||||||||||    
T  20229322 gaagaagaagcatattctaagtggccttgtggaaaatagtaaactcttgaatgcaacttt 20229263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University