View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1554_low_12 (Length: 234)

Name: NF1554_low_12
Description: NF1554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1554_low_12
NF1554_low_12
[»] chr4 (2 HSPs)
chr4 (118-227)||(1539254-1539363)
chr4 (3-75)||(1539408-1539480)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 118 - 227
Target Start/End: Complemental strand, 1539363 - 1539254
Alignment:
Q  118 tgccaccactttcgacacgtattcttgcattgtattgttacttctctggtttagcggaggaggttggattggttgggaaaatttttgcaacaccgcctaa 217  Q
    |||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||  ||||||||||||| |||    
T  1539363 tgccaccactttcgacacgtattcctgcgttgtattgttacttctctggtttggcggaggatgttggattggttgggaaaaaatttgcaacaccgcataa 1539264  T
Q  218 tttatttgtt 227  Q
    ||||||||||    
T  1539263 tttatttgtt 1539254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 3 - 75
Target Start/End: Complemental strand, 1539480 - 1539408
Alignment:
Q  3 cacagacagaccgtcaaaccaattacgtggaaaagataatgttagtatattggcctgtcagcacaccaccact 75  Q
    ||||||| ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
T  1539480 cacagacggaccgtcaaaccaattacagggaaaagataatgttagtatattggcctgtcagcacaccaccact 1539408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University