View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15549_low_13 (Length: 221)

Name: NF15549_low_13
Description: NF15549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15549_low_13
NF15549_low_13
[»] chr7 (2 HSPs)
chr7 (1-74)||(42741461-42741534)
chr7 (183-213)||(42741644-42741674)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 42741461 - 42741534
Alignment:
Q  1 agtgtatattagtcaaataaaatgaaatttattaaaataaagttacaatattccctcttgatattgacacagat 74  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  42741461 agtgtatattagtcaaataaaatgaaatttattaaaataaagttacaatattccctcttgatattgactcagat 42741534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 213
Target Start/End: Original strand, 42741644 - 42741674
Alignment:
Q  183 tatttttgctacaatcttcctttctttaccc 213  Q
    |||||||||||||||||||||||||||||||    
T  42741644 tatttttgctacaatcttcctttctttaccc 42741674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University