View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15544_high_36 (Length: 212)

Name: NF15544_high_36
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15544_high_36
NF15544_high_36
[»] chr4 (1 HSPs)
chr4 (45-158)||(35976631-35976744)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 45 - 158
Target Start/End: Original strand, 35976631 - 35976744
Alignment:
Q  45 aatttagtttgatgtactatcatgtaacccttaacacctccatgagatagcgtgctattaaatttacgaacgctttttctaaccaaagaaaattaagaac 144  Q
    |||||||||||||||||||||||||||||||||| ||||| |||||||||||||  |||||||||||||||||||||| |||||||||||||||||||||    
T  35976631 aatttagtttgatgtactatcatgtaacccttaaaacctcaatgagatagcgtgtaattaaatttacgaacgctttttgtaaccaaagaaaattaagaac 35976730  T
Q  145 gcgttttaagaaag 158  Q
    ||||||||||||||    
T  35976731 gcgttttaagaaag 35976744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University