View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15544_high_35 (Length: 213)

Name: NF15544_high_35
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15544_high_35
NF15544_high_35
[»] chr3 (1 HSPs)
chr3 (12-193)||(36622057-36622238)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 36622238 - 36622057
Alignment:
Q  12 agaagcaaagggaagagatagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctcca 111  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36622238 agaagcaaggggaagagatagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctcca 36622139  T
Q  112 gttaaaggtttctattgaggacctgaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttct 193  Q
     ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36622138 attaaaggtttctattgaggacctcaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttct 36622057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University