View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15543_high_11 (Length: 302)

Name: NF15543_high_11
Description: NF15543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15543_high_11
NF15543_high_11
[»] chr3 (1 HSPs)
chr3 (35-302)||(35205403-35205670)


Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 35 - 302
Target Start/End: Complemental strand, 35205670 - 35205403
Alignment:
Q  35 ggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcggagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtca 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35205670 ggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcggagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtca 35205571  T
Q  135 ttggttattgggattttgcaatctgcaaattcgagtgcggagaaggagtactgtgtttccattttggtttcactatgtgttaatgttggtggagaggttg 234  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35205570 ttggttattgggattttgcaatctgcaaattcgcgtgcggagaaggagtactgtgtttccattttggtttcactatgtgttaatgttggtggagaggttg 35205471  T
Q  235 ttagtgttttggcgaagcatgcttcggggattatgcctttgctttatgcaaatcttacctatgctact 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
T  35205470 ttagtgttttggcgaagcatgcttcggggattatgcctttgctttatgcaaatcttaccgatggtact 35205403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University