View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15540_low_18 (Length: 201)

Name: NF15540_low_18
Description: NF15540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15540_low_18
NF15540_low_18
[»] chr7 (2 HSPs)
chr7 (1-109)||(33344563-33344671)
chr7 (1-72)||(33332980-33333051)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 33344671 - 33344563
Alignment:
Q  1 gatgatcactagttccaaactgtgatgactgatgatagtgtcaaaaccttttattttgataacccttctgttagataaaggttcaattttgtgattagat 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
T  33344671 gatgatcactagttccaaattgtgatgactgatgatagtgtcaaaaccttggattttgataacccttctgttagataaaggttcaattttgtgattagat 33344572  T
Q  101 ttagggggc 109  Q
    |||||||||    
T  33344571 ttagggggc 33344563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 33333051 - 33332980
Alignment:
Q  1 gatgatcactagttccaaactgtgatgactgatgatagtgtcaaaaccttttattttgataacccttctgtt 72  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||||  ||||||||||||||||||||    
T  33333051 gatgatcactagtttcaaattgtgatgactgatgatagtgtcaaaaccttggattttgataacccttctgtt 33332980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University