View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1553_low_21 (Length: 243)

Name: NF1553_low_21
Description: NF1553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1553_low_21
NF1553_low_21
[»] chr8 (1 HSPs)
chr8 (18-243)||(32596711-32596936)


Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 32596936 - 32596711
Alignment:
Q  18 cgatttttcttcaggttttctcttgcagacatcatgggttacttcaatttcgatgccgagttcaaattgttacgctttcaataattcaagtcgaattgtt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32596936 cgatttttcttcaggttttctcttgcagacatcatgggttacttcaatttcgatgccgagttcaaattgttacgctttcaataattcaagtcgaattgtt 32596837  T
Q  118 gatttcgtatccttcatttccacatgcttcaagttttcaacttttattaggcattgcattttaacgttactaattgcaaatgggtcattattggattcta 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32596836 gatttcgtatccttcatttccacatgcttcaagttttcaacttttattaggcattgcattttaacgttactaattgcaaatgggtcattattggattcta 32596737  T
Q  218 attttagtatattatggatgtttttt 243  Q
    ||||||||||||||||||||||||||    
T  32596736 attttagtatattatggatgtttttt 32596711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University