View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15538_low_28 (Length: 219)

Name: NF15538_low_28
Description: NF15538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15538_low_28
NF15538_low_28
[»] chr8 (1 HSPs)
chr8 (52-201)||(13211868-13212017)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 52 - 201
Target Start/End: Original strand, 13211868 - 13212017
Alignment:
Q  52 cacatgctaccttctgctgcttcatttggaagcaactaagaacatttttagctgaacaagaaaattaatttaactgttttggatgcaatatcataaaatt 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13211868 cacatgctaccttctgctgcttcatttggaagcaactaagaacatttttagctgaacaagaaaattaatttaactgttttggatgcaatatcataaaatt 13211967  T
Q  152 caaaccccacaaaaaattcatgaatttatacatccttctttcaattcaac 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13211968 caaaccccacaaaaaattcatgaatttatacatccttctttcaattcaac 13212017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University