View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15532_low_20 (Length: 255)

Name: NF15532_low_20
Description: NF15532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15532_low_20
NF15532_low_20
[»] chr7 (1 HSPs)
chr7 (1-242)||(32861622-32861848)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 32861622 - 32861848
Alignment:
Q  1 ccatggttttaaattgtggttgcgtatgcggttgcggttgcggacacaacgattgtggacattgcagttgttgcgatgcttattgcagtcattgcagcgt 100  Q
    |||||||||||||||||||| ||||||||||||||||      ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||    
T  32861622 ccatggttttaaattgtggtcgcgtatgcggttgcgg------acacaacgattgtggacattgcagttgttgcaatgcttattgcagtcgttgcagcgt 32861715  T
Q  101 ggacacgacactgatattgacatattgactggtaaaaatttaagaaaatgaacgtaatcacatgtgttgttgtcggatattagacatgcccttgatcaaa 200  Q
    ||||||||| ||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||    
T  32861716 ggacacgac-ctgatattgag--------tggtaaaaatttaagaaaatgaacgtaatcacatgtgttgttgtcggatattggacatgcctttgatcaaa 32861806  T
Q  201 ggtattagtgatataaagttcacaagtctctcatttcatctc 242  Q
    |||||||||||||||||||||||| |||||||||||||||||    
T  32861807 ggtattagtgatataaagttcacatgtctctcatttcatctc 32861848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University