View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15531_low_34 (Length: 211)

Name: NF15531_low_34
Description: NF15531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15531_low_34
NF15531_low_34
[»] chr2 (1 HSPs)
chr2 (20-172)||(38366315-38366471)
[»] chr5 (1 HSPs)
chr5 (109-154)||(2615797-2615842)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 172
Target Start/End: Original strand, 38366315 - 38366471
Alignment:
Q  20 aggaacgcgtcatcctttcttctaagaccatggaggcagaggagattgttgaacgatcaaagtgatttttagctaggagcaaagcgggatcttgtat--- 116  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
T  38366315 aggaacacgtcatcctttcttctaagaccatggaggcagaggagattgttgaacgatcaaagtgatttttagctaggagcaaagcgggatcttgtatgta 38366414  T
Q  117 -gtactatgaatgattttcaaactctttgatttgtattttgtcgcgatttagttagg 172  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38366415 cgtactatgaatgattttcaaactctttgatttgtattttgtcgcgatttagttagg 38366471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 2615842 - 2615797
Alignment:
Q  109 tcttgtatgtactatgaatgattttcaaactctttgatttgtattt 154  Q
    |||| |||||||||||||||||||| |||  |||||||||||||||    
T  2615842 tcttatatgtactatgaatgatttttaaatcctttgatttgtattt 2615797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University