View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15522_high_6 (Length: 204)

Name: NF15522_high_6
Description: NF15522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15522_high_6
NF15522_high_6
[»] chr5 (2 HSPs)
chr5 (81-191)||(4948969-4949081)
chr5 (15-44)||(4949118-4949147)


Alignment Details
Target: chr5 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 81 - 191
Target Start/End: Complemental strand, 4949081 - 4948969
Alignment:
Q  81 tcgttgttaagtaaacttattgatgtagtagattaaat--tccttcaaatggttaattttgaatgattaaagcctgtcgtatgcttcccaggagatcctt 178  Q
    |||||||| |||||||||||||||||||||||||||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4949081 tcgttgttgagtaaacttattgatgtagtagattaaatattccttcaaatggttaattttggatgattaaagcctgtcgtatgcttcccaggagatcctt 4948982  T
Q  179 tgctgtcacacag 191  Q
    |||||||||||||    
T  4948981 tgctgtcacacag 4948969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 44
Target Start/End: Complemental strand, 4949147 - 4949118
Alignment:
Q  15 atagtaaccctagaatccttatcaaaggac 44  Q
    ||||||||||||||||||||||||||||||    
T  4949147 atagtaaccctagaatccttatcaaaggac 4949118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University