View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15513_high_23 (Length: 208)

Name: NF15513_high_23
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15513_high_23
NF15513_high_23
[»] chr2 (1 HSPs)
chr2 (18-167)||(38883312-38883461)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 167
Target Start/End: Original strand, 38883312 - 38883461
Alignment:
Q  18 ttattatccatgttggtgttctgcaacagcattatgtcctttgtggcaacatcatcagtttgcacactctccatccccctaaaggttttcagttggaaat 117  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  38883312 ttattatccatgttggtgttctgcaacagcattacgtcctttgtggcaacatcatcagtttgcatactctccatccccctaaaggttttcagttggaaat 38883411  T
Q  118 ctatgctagcattgtggtcattgtctttctacctgttaagttgcttcttg 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38883412 ctatgctagcattgtggtcattgtctttctacctgttaagttgcttcttg 38883461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University