View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1550_low_9 (Length: 269)

Name: NF1550_low_9
Description: NF1550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1550_low_9
NF1550_low_9
[»] chr2 (1 HSPs)
chr2 (18-269)||(41572544-41572796)
[»] chr8 (2 HSPs)
chr8 (22-267)||(27753710-27753956)
chr8 (105-163)||(10909508-10909566)
[»] chr3 (1 HSPs)
chr3 (20-268)||(21942062-21942311)
[»] chr4 (2 HSPs)
chr4 (105-163)||(13725863-13725921)
chr4 (102-160)||(26728806-26728864)


Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 41572796 - 41572544
Alignment:
Q  18 gctatggagcttccggttaacatgtttctgctgtggaaggaatggaatgtggcagcagggagtaacaagatccgtaagggattccgtttgatttggcacg 117  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  41572796 gctatggagcttccggttaacatgtttctgctgtgggaggaatggaatgtggcagcagggagtaacaagatccgtaagggattccgtttgatttggcatg 41572697  T
Q  118 ccgtagtgtggaatttattgagggtgagaaatgatcgaattttcaaaaatgtggtttgtc-ggtggagggtacggtggaggctgtgaaggttatatcgag 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |    
T  41572696 ccgtagtgtggaatttattgagggtgagaaatgatcgaattttcaaaaatgtggtttgtcaggtggagggtacggtggaggctgtgaaggttatatcgtg 41572597  T
Q  217 gagatgtattctttgccgtttgaaggtgccggcgtgtttgttctacgagtgga 269  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  41572596 gagatgtattcttagccgtttgaaggtgccggcgtgtttgttctacgagtgga 41572544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 22 - 267
Target Start/End: Original strand, 27753710 - 27753956
Alignment:
Q  22 tggagcttccggttaacatgtttctgctgtggaaggaatggaatgtggcagcagggagtaacaagatccgtaagggattccgtttgatttggcacgccgt 121  Q
    ||||||||||| | ||  |||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||    
T  27753710 tggagcttccgatcaatttgtttctgctgtgggaggattggaatgtggcagcagggagtaataagatccgtaagggattccggttgatttggcacgccgt 27753809  T
Q  122 agtgtggaatttattgagggtgagaaatgatcgaattttcaaaaatgtggtttgtc-ggtggagggtacggtggaggctgtgaaggttatatcgaggaga 220  Q
    |||||||||||||| ||||||||||||||| |||||||||||||||| ||||| || |||||||| |||||||||||||||||||||||| ||| |||||    
T  27753810 agtgtggaatttatggagggtgagaaatgaccgaattttcaaaaatgcggtttatcgggtggaggatacggtggaggctgtgaaggttatgtcgtggaga 27753909  T
Q  221 tgtattctttgccgtttgaaggtgccggcgtgtttgttctacgagtg 267  Q
    ||  ||||| |||||||||||||||||||||||||||||||||||||    
T  27753910 tggtttcttagccgtttgaaggtgccggcgtgtttgttctacgagtg 27753956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 105 - 163
Target Start/End: Complemental strand, 10909566 - 10909508
Alignment:
Q  105 ttgatttggcacgccgtagtgtggaatttattgagggtgagaaatgatcgaattttcaa 163  Q
    ||||||||||||||||  || |||| ||||| |||||||||||||||||||||||||||    
T  10909566 ttgatttggcacgccgcggtttggagtttatggagggtgagaaatgatcgaattttcaa 10909508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 268
Target Start/End: Complemental strand, 21942311 - 21942062
Alignment:
Q  20 tatggagcttccggttaacatgtttctgctgtggaaggaatggaatgtggcagcagggagtaacaagatccgtaagggattccgtttgatttggcacgcc 119  Q
    ||||||||||| | | ||  ||||| |||||||| |||  |||||||||||||| || | |||   ||| || ||||| ||||| ||| ||||||| |||    
T  21942311 tatggagcttctgttaaatttgtttgtgctgtgggaggtctggaatgtggcagcgggtaataatgggattcgcaagggcttccggttggtttggcatgcc 21942212  T
Q  120 gtagtgtggaatttattgagggtgagaaatgatcgaattttcaaaaatgtggtttgt-cggtggagggtacggtggaggctgtgaaggttatatcgagga 218  Q
    || ||||| ||| | | |||||||||||||||||  |||||||||||||  ||||||  |||| ||| |||||||||||| |||||||| || ||| |||    
T  21942211 gtcgtgtgaaatctttggagggtgagaaatgatcttattttcaaaaatgcagtttgtggggtgaaggatacggtggaggcagtgaaggtaatgtcgtgga 21942112  T
Q  219 gatgtattctt-tgccgtttgaaggtgccggcgtgtttgttctacgagtgg 268  Q
    ||||  |||||  ||||||| ||| ||||| ||||||||||||||||||||    
T  21942111 gatg-gttcttgagccgtttaaagatgccgacgtgtttgttctacgagtgg 21942062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 105 - 163
Target Start/End: Original strand, 13725863 - 13725921
Alignment:
Q  105 ttgatttggcacgccgtagtgtggaatttattgagggtgagaaatgatcgaattttcaa 163  Q
    ||||||||||||||||  || |||| ||||| ||||| |||||||||||||||||||||    
T  13725863 ttgatttggcacgccgcggtttggagtttatggagggcgagaaatgatcgaattttcaa 13725921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 26728806 - 26728864
Alignment:
Q  102 cgtttgatttggcacgccgtagtgtggaatttattgagggtgagaaatgatcgaatttt 160  Q
    |||||||||||||| ||||| ||||||| | ||| ||||| ||||||||| ||||||||    
T  26728806 cgtttgatttggcatgccgtggtgtggagtatatggagggcgagaaatgagcgaatttt 26728864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University