View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15509_high_5 (Length: 250)

Name: NF15509_high_5
Description: NF15509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15509_high_5
NF15509_high_5
[»] chr3 (2 HSPs)
chr3 (95-229)||(3134216-3134349)
chr3 (1-56)||(3134341-3134396)


Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 95 - 229
Target Start/End: Complemental strand, 3134349 - 3134216
Alignment:
Q  95 taggtaattagtatgtgttgaatgaaaatgatgaaaatttcaactgaagatattcaaatcaaatcaaatagataatatgccaacgattgtcgattttgct 194  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3134349 taggtaatt-gtatgtgttgaataaaaatgatgaaaatttcaactgaagatattcaaatcaaatcaaatagataatatgccaacgattgtcgattttgct 3134251  T
Q  195 cttctctaaggcaaactcccgattttaacaacctt 229  Q
    | ||||| |||||||||||||||||||||||||||    
T  3134250 catctctgaggcaaactcccgattttaacaacctt 3134216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3134396 - 3134341
Alignment:
Q  1 ttgtacaaaatcaagattcaaaaagaaaattgcgagaagaaagaatataggtaatt 56  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  3134396 ttgtacaaaatcaagattgaaaaagaaaattgcgagaagaaagaatataggtaatt 3134341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University