View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15506_low_1 (Length: 458)

Name: NF15506_low_1
Description: NF15506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15506_low_1
NF15506_low_1
[»] chr1 (2 HSPs)
chr1 (177-270)||(3401160-3401253)
chr1 (264-346)||(3400992-3401066)


Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 177 - 270
Target Start/End: Complemental strand, 3401253 - 3401160
Alignment:
Q  177 tttcttactgattataaacaatagagaatatgcatgatctatttgccgttcacttaatttcttaatttaggtaccttgtttactatatttgtca 270  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||    
T  3401253 tttcttactgattataaacaatagagaatatgcatgatctattttccattcacttaatttcttaatttaggtaccttgtttactacatttgtca 3401160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 264 - 346
Target Start/End: Complemental strand, 3401066 - 3400992
Alignment:
Q  264 tttgtcatcaacacccattgtggtttggatattagtattttagttttttagatggtgttatttgatatcaatagccattcgac 346  Q
    ||||| ||||||| |||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||    
T  3401066 tttgtaatcaacatccattgtggtttggatattagtattttag--------atggtgttatttgatatcaatagccattcgac 3400992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University