View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15504_low_7 (Length: 364)

Name: NF15504_low_7
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15504_low_7
NF15504_low_7
[»] chr1 (2 HSPs)
chr1 (1-158)||(44992968-44993125)
chr1 (226-336)||(44992791-44992901)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 44993125 - 44992968
Alignment:
Q  1 ctatcatgcatagaagatatggcataaaataattgtcaactcatattctcatgacgtttagtgctttctagttggatacttatgcccatatgtccctgta 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44993125 ctatcatgcatagaagatatgccataaaataattgtcaactcatattctcatgacgtttagtgctttctagttggatacttatgcccatatgtccctgta 44993026  T
Q  101 attaatatcatagactcataggatatgtaaaaatctaacttattttgctatcaaacta 158  Q
    ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||    
T  44993025 attaatatcatagactcatagtatatgtaaaaatctaacttcttttgctatcaaacta 44992968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 226 - 336
Target Start/End: Complemental strand, 44992901 - 44992791
Alignment:
Q  226 cccactttcatatgcttctcttttcctatttatattacattttgggacctttttgcttctggtagcttgttgtcgtcttattcctccactttccccatct 325  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  44992901 cccactttcatatgcttctcttttcctatttatattacattttgggacctttttccttctggtagcttgttgtcgtcttattcctccactttccccatct 44992802  T
Q  326 ttttggtttct 336  Q
    |||||||||||    
T  44992801 ttttggtttct 44992791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University