View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15504_low_15 (Length: 210)

Name: NF15504_low_15
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15504_low_15
NF15504_low_15
[»] chr6 (4 HSPs)
chr6 (67-195)||(1684792-1684915)
chr6 (15-53)||(1684912-1684950)
chr6 (15-55)||(1971390-1971430)
chr6 (73-106)||(1695202-1695235)


Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 67 - 195
Target Start/End: Complemental strand, 1684915 - 1684792
Alignment:
Q  67 attttagaatgttctgttttttctttcgatcacctaattaagttcatgatgtgttattattcgcataagttttatctttatacttaagagatgagatggt 166  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||    
T  1684915 attttcgaatgttctgttttttctttctatcacctaattaagttcatgatgtgttattattcgcataagttttatctttatacttaaga-----gatggt 1684821  T
Q  167 tgtgtaaaatgataaatattgtcacttgt 195  Q
    |||||||||||||||||||||||||||||    
T  1684820 tgtgtaaaatgataaatattgtcacttgt 1684792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 1684950 - 1684912
Alignment:
Q  15 gaagggtatgtatgctttcacactatgattatggcattt 53  Q
    |||||||||||||||||||||||||||||||||||||||    
T  1684950 gaagggtatgtatgctttcacactatgattatggcattt 1684912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 1971430 - 1971390
Alignment:
Q  15 gaagggtatgtatgctttcacactatgattatggcatttat 55  Q
    |||||||| ||||||||||||||||||||||||| ||||||    
T  1971430 gaagggtacgtatgctttcacactatgattatggtatttat 1971390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 106
Target Start/End: Complemental strand, 1695235 - 1695202
Alignment:
Q  73 gaatgttctgttttttctttcgatcacctaatta 106  Q
    |||||||||||||||||||||||| |||||||||    
T  1695235 gaatgttctgttttttctttcgattacctaatta 1695202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University