View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15503_high_21 (Length: 214)

Name: NF15503_high_21
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15503_high_21
NF15503_high_21
[»] chr3 (1 HSPs)
chr3 (52-201)||(52780317-52780466)
[»] chr4 (1 HSPs)
chr4 (83-189)||(17470861-17470967)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 52 - 201
Target Start/End: Original strand, 52780317 - 52780466
Alignment:
Q  52 tgatcgtcttcctgcgttgttaaggccagttttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgat 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52780317 tgatcgtcttcctgcgttgttaaggccagttttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgat 52780416  T
Q  152 actctttccaagatgctattctttttgtccctattcctcttcatctcact 201  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||    
T  52780417 actctttccaagatgctattctttttgtccctattcctcttcatgtcact 52780466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 83 - 189
Target Start/End: Original strand, 17470861 - 17470967
Alignment:
Q  83 ttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttccaagatgctattctttttgtccc 182  Q
    ||||||||||||||||| || ||| || ||||||||||||||||| ||||| ||  |||  | |||||||||  ||| |||||||| |||||| | ||||    
T  17470861 ttcttcttgttctttgctgctcctagtatggctagtttggcttggcaatctgtttgtggttactttgatactgcttctaagatgctgttctttctctccc 17470960  T
Q  183 tattcct 189  Q
    | |||||    
T  17470961 tcttcct 17470967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University