View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15502_high_4 (Length: 245)

Name: NF15502_high_4
Description: NF15502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15502_high_4
NF15502_high_4
[»] chr3 (2 HSPs)
chr3 (111-177)||(440124-440190)
chr3 (117-149)||(453033-453065)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 440190 - 440124
Alignment:
Q  111 tcaggcggtggtggaagcggaggagattatggtggtggaagtggaggaggtagttctggcggcggaa 177  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  440190 tcaggtggtggtggaagcggaggagattatggtggtggaagtggaggaggtagttctggcggcggaa 440124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Complemental strand, 453065 - 453033
Alignment:
Q  117 ggtggtggaagcggaggagattatggtggtgga 149  Q
    |||||||| ||||||||||||||||||||||||    
T  453065 ggtggtggcagcggaggagattatggtggtgga 453033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University