View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1549_low_17 (Length: 222)

Name: NF1549_low_17
Description: NF1549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1549_low_17
NF1549_low_17
[»] chr4 (1 HSPs)
chr4 (17-204)||(25476347-25476534)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 25476534 - 25476347
Alignment:
Q  17 taggtattaaaattgaaatggagcaggaaaatcaaaccccatttgagcagcaatattcaaaaatcacaaaaattttgaaagtcgattttgttagagtaaa 116  Q
    |||||||| ||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||    
T  25476534 taggtattgaaattgaaatggagcagaaaaatcaaaccccgtttgagcagcagtattcaaaaatcacaaaaattttgagagtcaattttgttagagtaaa 25476435  T
Q  117 atatttacatatacctatcaaaatcctcattgttgaccaagtattgcacatgcaccgactgagatgaagaatcgacaactttcccttt 204  Q
    ||||||||||||||||||||||||||||  |||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||    
T  25476434 atatttacatatacctatcaaaatcctcggtgttgagcaagtattgcacatgcaccgattgagatgaagaatcgacgactttcccttt 25476347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University