View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1548_low_37 (Length: 215)

Name: NF1548_low_37
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1548_low_37
NF1548_low_37
[»] chr1 (1 HSPs)
chr1 (1-196)||(38899793-38899991)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 38899991 - 38899793
Alignment:
Q  1 ataggatgataaggaggcttttattgaaatccatcatctcttctcttcgaaaaat--tcaaagagcagagataaatggagaccgtaaaattcaggttgta 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||| ||||| ||||||||||||||||| ||||||||||    
T  38899991 ataggatgataaggaggcttttattgaaatccatcatctcttctcttcgaaaaatattcaaagaggagagacaaatggagaccgtaaaactcaggttgta 38899892  T
Q  99 acat--gactcttgtttataagggtcgagtttaattttttgtaggtggaaacagaatttccacacaaactttgacacttttttcagttattaatcatagg 196  Q
    ||||  ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  38899891 acatatgactcttgtttataagggtcgagtttaattttt-gtaggtggaaacagaatttccacacaaattttgacacttttttcagttattaatcatagg 38899793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University