View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15489_high_22 (Length: 255)

Name: NF15489_high_22
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15489_high_22
NF15489_high_22
[»] chr1 (1 HSPs)
chr1 (30-129)||(52000310-52000409)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 30 - 129
Target Start/End: Original strand, 52000310 - 52000409
Alignment:
Q  30 gaaagatggattttaaacacatgattcctcgtatgtgctttatagttttaaacatatgactaaattatgcttttagcttggtttcaacaataccactaga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52000310 gaaagatggattttaaacacatgattcctcgtatgtgctttatagttttaaacatatgactaaattatgcttttagcttggtttcaacaataccactaga 52000409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University