View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15482_low_4 (Length: 306)

Name: NF15482_low_4
Description: NF15482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15482_low_4
NF15482_low_4
[»] chr3 (2 HSPs)
chr3 (14-182)||(38255655-38255815)
chr3 (232-291)||(38255599-38255658)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 14 - 182
Target Start/End: Complemental strand, 38255815 - 38255655
Alignment:
Q  14 atatcacaaaataaaggaccgaaaaaataatctattctcaaagattatccctctcaaatttgcaatgtttctatacttagtattaattcttcttaatata 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||       |||||||||    
T  38255815 atatcacaaaataaaggaccgaaaaaataatctattctcaaagattatccctctcaaatttgcaatgtt-ctatacttagtatt-------cttaatata 38255724  T
Q  114 tagtaacaatcccacatagtcctgggtttacataaacatgatgaattgaaatttcacttgtgattatca 182  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38255723 tagtaacaatcccacatagtcctgggtttacataaacatgatgaattgaaatttcacttgtgattatca 38255655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 232 - 291
Target Start/End: Complemental strand, 38255658 - 38255599
Alignment:
Q  232 atcatatgaatttaaccagctgaagatatatactctagagaaatccgaggcaaaaaacct 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38255658 atcatatgaatttaaccagctgaagatatatactctagagaaatccgaggcaaaaaacct 38255599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University