View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1547_low_56 (Length: 232)

Name: NF1547_low_56
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1547_low_56
NF1547_low_56
[»] chr4 (1 HSPs)
chr4 (10-217)||(51655832-51656038)


Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 51656038 - 51655832
Alignment:
Q  10 tgagatgaagttgtgtactataaaactatatacctaaataacactcgccgcccaacaaaatcatgcttagtgtgattatttcctcccatagtattttgaa 109  Q
    ||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||    
T  51656038 tgagacgaagtcgtgtactataaaactatatacctaaatagcactcgccgcccaacaaaatcatgcttagtgtgattctttccccccatagtattttgaa 51655939  T
Q  110 tagaatcataaagtttgaatgggtaaaatgagatcagataaaaggttacatcatttacannnnnnnnagtttcgtagcggccttttatcttctttaaaat 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||    
T  51655938 tagaatcataaagtttgaatgggtaaaatgagatcagataaaaggttacatcatttaca-tttttttagtttcgtagcggccttttatcttctttaaaat 51655840  T
Q  210 gttacatc 217  Q
    ||||||||    
T  51655839 gttacatc 51655832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University