View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1547_high_3 (Length: 537)

Name: NF1547_high_3
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1547_high_3
NF1547_high_3
[»] chr5 (2 HSPs)
chr5 (354-434)||(42438752-42438833)
chr5 (450-482)||(42567217-42567249)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 2e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 354 - 434
Target Start/End: Original strand, 42438752 - 42438833
Alignment:
Q  354 cgttcaagaataccttgatta-tacatgctttcccgtaagctcgaagacgccgtcaatgccgccgttagagccaaaacctcc 434  Q
    |||||||||||| |||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  42438752 cgttcaagaatatcttgataaatacatgctttcccgtaaactcgaagacgccgtcaatgccgccgttagagccaaaacctcc 42438833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 482
Target Start/End: Complemental strand, 42567249 - 42567217
Alignment:
Q  450 ttctcaatgcagagtttattatagttttgagtt 482  Q
    ||||||||||| |||||||||||||||||||||    
T  42567249 ttctcaatgcatagtttattatagttttgagtt 42567217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University