View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15478_low_5 (Length: 249)

Name: NF15478_low_5
Description: NF15478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15478_low_5
NF15478_low_5
[»] chr3 (1 HSPs)
chr3 (1-121)||(23175250-23175370)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 23175370 - 23175250
Alignment:
Q  1 agatgcatataagccattgcttgaaacccttgtcatgcacaggaagaatatggcttatttctgaaaactacacaattattacaagatttcccctaaaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23175370 agatgcatataagccattgcttgaaacccttgtcatgcataggaagaatatggcttatttctgaaaactacacaattattacaagatttcccctaaaaaa 23175271  T
Q  101 gaaaagctggtagtgcaaaag 121  Q
     || |||||||||||||||||    
T  23175270 taatagctggtagtgcaaaag 23175250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University