View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15475_low_10 (Length: 228)

Name: NF15475_low_10
Description: NF15475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15475_low_10
NF15475_low_10
[»] chr2 (1 HSPs)
chr2 (73-228)||(12690140-12690295)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 73 - 228
Target Start/End: Complemental strand, 12690295 - 12690140
Alignment:
Q  73 gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacagttaattgtgtatgattatat 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  12690295 gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacaattaattgtgtatgattatat 12690196  T
Q  173 atttaattgaaacgatgcaaaataatagaggaacttttatcgtatatgccgatgtc 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||    
T  12690195 atttaattgaaacgatgcaaaataatagaggaacttttatcgtatacgctgatgtc 12690140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University