View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15468_low_2 (Length: 306)

Name: NF15468_low_2
Description: NF15468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15468_low_2
NF15468_low_2
[»] chr5 (2 HSPs)
chr5 (152-239)||(1846241-1846328)
chr5 (250-289)||(1846163-1846202)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 152 - 239
Target Start/End: Complemental strand, 1846328 - 1846241
Alignment:
Q  152 agaatgagaaggatgattgatgactaaccccagagtctcattgttaatgtcaactaggaattatgtatttttagaccaagagagattt 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1846328 agaatgagaaggatgattgatgactaaccccagagtctcattgttaatgtcaactaggaattatgtatttttagaccaagagagattt 1846241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 250 - 289
Target Start/End: Complemental strand, 1846202 - 1846163
Alignment:
Q  250 ggggctacaagtgtgaacactgaccatgttagaagttagt 289  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  1846202 ggggctacaagtgtgaacactgaccatgttagaagttagt 1846163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University