View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15465_low_108 (Length: 233)

Name: NF15465_low_108
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15465_low_108
NF15465_low_108
[»] chr1 (1 HSPs)
chr1 (43-137)||(3102314-3102408)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 43 - 137
Target Start/End: Original strand, 3102314 - 3102408
Alignment:
Q  43 gccacacaccatctccaatctcgtttttcttcaaatcgagtaagtttttcaatttttcttctctcattcttcgatttcctctattggtagaaacc 137  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3102314 gccacacaccatctccaatctcgtttttcttcaaatcgagtaagtttttcaatttttcttctctcattcttcgatttcctctattggtagaaacc 3102408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University