View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15465_high_99 (Length: 233)

Name: NF15465_high_99
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15465_high_99
NF15465_high_99
[»] chr1 (1 HSPs)
chr1 (1-216)||(14871175-14871387)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 14871387 - 14871175
Alignment:
Q  1 tttttgcatagaacgatcaagttaaataacaagactaattatatttttattttgataattaattcattgaaataagctcccaacaacgattttgctttga 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14871387 tttttgcacagaacgatcaagttaaataacaagactaattatatttttattttgataattaattcattgaaataagctcccaacaacgattttgctttga 14871288  T
Q  101 tttggcattgaacgcatccacatgagaaatccatccaccttcttcattccgattattcatggaagcagctgcagaaagatccaatccaaccatgcgctgc 200  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||    
T  14871287 tttggcattgaacacatccacatgagaaatccatccaccttcttcattccg---attcatggaagcagctgcagaaagatccaatccaaccatgcgctgc 14871191  T
Q  201 ggttgtaggcgaggtg 216  Q
    ||||||||||||||||    
T  14871190 ggttgtaggcgaggtg 14871175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University