View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15458_low_24 (Length: 250)

Name: NF15458_low_24
Description: NF15458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15458_low_24
NF15458_low_24
[»] chr2 (1 HSPs)
chr2 (88-224)||(37793742-37793876)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 88 - 224
Target Start/End: Complemental strand, 37793876 - 37793742
Alignment:
Q  88 gaagaatcgtcgtaaagcattaaatgtaaaataaagcaggaatattcttcttattactattaactattttgagagatagagagagatggtaaacaaaaaa 187  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||    
T  37793876 gaagaatcgtcataaagcattaaatgtaaaataaagcaggaatattcttcttatta--attaactattttgagagatagagagagatggtaaacaaaaaa 37793779  T
Q  188 tatagaagcgagaaagaaatgctattttatttcaaat 224  Q
    |||||||||||||||||||||||||||||||||||||    
T  37793778 tatagaagcgagaaagaaatgctattttatttcaaat 37793742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University