View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15458_high_17 (Length: 240)

Name: NF15458_high_17
Description: NF15458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15458_high_17
NF15458_high_17
[»] chr5 (2 HSPs)
chr5 (139-204)||(10463238-10463303)
chr5 (43-86)||(10463367-10463410)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 139 - 204
Target Start/End: Complemental strand, 10463303 - 10463238
Alignment:
Q  139 cccgaaatttaatgggacaggtgagatttaatacgtagcgttatttgttacatttatttcaattcc 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10463303 cccgaaatttaatgggacaggtgagatttaatacgtagcgttatttgttacatttatttcaattcc 10463238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 10463410 - 10463367
Alignment:
Q  43 cactcgaatcgctacagcaacttggcatttttgtcattatattt 86  Q
    |||||||||| |||||||||||||||||||||||||||||||||    
T  10463410 cactcgaatcactacagcaacttggcatttttgtcattatattt 10463367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University