View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15456_low_73 (Length: 220)

Name: NF15456_low_73
Description: NF15456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15456_low_73
NF15456_low_73
[»] chr8 (1 HSPs)
chr8 (17-202)||(45047842-45048030)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 45048030 - 45047842
Alignment:
Q  17 attaaccatacctattcaaactgaagttttgaaagttgtagatatgattggctttcacacatctcgtcttgttttgtttacgtgaa---acatgaatcca 113  Q
    ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||   ||     |   |||||||    
T  45048030 attaaacatacctattcaaactgaaattttgaaagttgtagatatgattggctttcacacatcttgtcttgttttgtttgtttgtttgcagtcgaatcca 45047931  T
Q  114 aaagtgtcatagtggatagaattttgggtggccaatattcatgagaatattgtctactaagattcatacgggcttcattcaattcgtct 202  Q
    ||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||    
T  45047930 aaagtgtcatagtggatagaattttggctggccaatattcattagaatattgcctactaagattcatacgggcttcattcaattcgtct 45047842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University