View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15455_low_21 (Length: 208)

Name: NF15455_low_21
Description: NF15455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15455_low_21
NF15455_low_21
[»] chr7 (4 HSPs)
chr7 (19-191)||(8361447-8361622)
chr7 (136-177)||(8354833-8354874)
chr7 (92-135)||(8410769-8410812)
chr7 (90-135)||(8355114-8355159)
[»] chr4 (1 HSPs)
chr4 (89-135)||(51650279-51650325)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 8361622 - 8361447
Alignment:
Q  19 ggataaggcttagtctaggagtatatatag--tgctgatcgcaactttgtgcttgggttgtttttt--gaacctcatctttccattgtcctactctcaac 114  Q
    |||||||||||||||||||||||||||||   ||||||||||||| ||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
T  8361622 ggataaggcttagtctaggagtatatatataatgctgatcgcaaccttgtgcttgggttgttttttttgaacctcatctttccattgtcctactctcaac 8361523  T
Q  115 aagtcaattgggaatggtgtggaaagaaaattgctggtttttggtatggaattggcttttagatgcaggtttccttt 191  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||    
T  8361522 aagtcaattgggaatggtgtggaaagaaaattgctgg-ttttggtatggagttggcttttagatgtaggtttccttt 8361447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 177
Target Start/End: Complemental strand, 8354874 - 8354833
Alignment:
Q  136 gaaagaaaattgctggtttttggtatggaattggcttttaga 177  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
T  8354874 gaaagaaaattgctggtttttggaatggaattggcttttaga 8354833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 135
Target Start/End: Complemental strand, 8410812 - 8410769
Alignment:
Q  92 ctttccattgtcctactctcaacaagtcaattgggaatggtgtg 135  Q
    ||||||||||||||||||||||| || |||||||||||||||||    
T  8410812 ctttccattgtcctactctcaaccagacaattgggaatggtgtg 8410769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 90 - 135
Target Start/End: Complemental strand, 8355159 - 8355114
Alignment:
Q  90 atctttccattgtcctactctcaacaagtcaattgggaatggtgtg 135  Q
    ||||||||||| |||||||||||| ||| |||||||||||| ||||    
T  8355159 atctttccattttcctactctcaagaagacaattgggaatgatgtg 8355114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 51650279 - 51650325
Alignment:
Q  89 catctttccattgtcctactctcaacaagtcaattgggaatggtgtg 135  Q
    ||||||||| | ||||||||||||||||||||||||| |||||||||    
T  51650279 catctttccctcgtcctactctcaacaagtcaattggaaatggtgtg 51650325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University