View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15453_low_23 (Length: 264)

Name: NF15453_low_23
Description: NF15453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15453_low_23
NF15453_low_23
[»] chr4 (3 HSPs)
chr4 (139-214)||(22062275-22062350)
chr4 (1-86)||(22062345-22062430)
chr4 (206-248)||(22061287-22061329)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 22062350 - 22062275
Alignment:
Q  139 attttgctccagaattgcgttggatactgcaccttttttacatgcacatcttttagacttcgcatgttacacgggc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22062350 attttgctccagaattgcgttggatactgcaccttttttacatgcacatcttttagacttcgcatgttacacgggc 22062275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 22062430 - 22062345
Alignment:
Q  1 tagttcattgaatttgcactattttcccccaatttccagggttttagagttccaagatcatgttcccaaaattttgtttgattttg 86  Q
    |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||    
T  22062430 tagttcattgaatttgcactatttccccctaatttccagggttttagagttccaagatcatgtttccaaatttttgtttgattttg 22062345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 22061329 - 22061287
Alignment:
Q  206 tacacgggcaagttaaacaaacaaaaacagtagtcttagattt 248  Q
    ||||||||||||||||||||||||||||| ||||| |||||||    
T  22061329 tacacgggcaagttaaacaaacaaaaacaatagtcctagattt 22061287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University