View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15449_low_68 (Length: 227)

Name: NF15449_low_68
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15449_low_68
NF15449_low_68
[»] chr5 (2 HSPs)
chr5 (39-209)||(6411635-6411805)
chr5 (46-86)||(6408489-6408529)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 39 - 209
Target Start/End: Original strand, 6411635 - 6411805
Alignment:
Q  39 taagctcaatatcaatatataataggctatgggcttaaatttgaacagcacgattcagtgaactgatcaaaataatttgccgaagtctgtaattttttaa 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6411635 taagctcaatatcaatatataataggctatgggcttaaatttgaacagcacgattcagtgaactgatcaaaataatttgccgaagtctgtaattttttaa 6411734  T
Q  139 gatgggtggcaaataagaaacaagaagtatgtaaaactggatattttaaacctggttttgtacatattcgt 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6411735 gatgggtggcaaataagaaacaagaagtatgtaaaactggatattttaaacctggttttgtacatattcgt 6411805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 6408489 - 6408529
Alignment:
Q  46 aatatcaatatataataggctatgggcttaaatttgaacag 86  Q
    |||||| ||||||||||||||||||||||||||| ||||||    
T  6408489 aatatcgatatataataggctatgggcttaaattggaacag 6408529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University